Medium
The DNA sequence is composed of a series of nucleotides abbreviated as 'A', 'C', 'G', and 'T'.
"ACGAATTCCG" is a DNA sequence.When studying DNA, it is useful to identify repeated sequences within the DNA.
Given a string s that represents a DNA sequence, return all the 10-letter-long sequences (substrings) that occur more than once in a DNA molecule. You may return the answer in any order.
Example 1:
Input: s = “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”
Output: [“AAAAACCCCC”,”CCCCCAAAAA”]
Example 2:
Input: s = “AAAAAAAAAAAAA”
Output: [“AAAAAAAAAA”]
Constraints:
1 <= s.length <= 105s[i] is either 'A', 'C', 'G', or 'T'.class Solution {
fun findRepeatedDnaSequences(s: String): List<String> {
if (s.length < 10) {
return emptyList()
}
val seen = BooleanArray(1024 * 1024)
val added = BooleanArray(1024 * 1024)
val chars = s.toCharArray()
var buf = 0
val map = IntArray(128)
map['A'.code] = 0
map['C'.code] = 1
map['G'.code] = 2
map['T'.code] = 3
val ans: MutableList<String> = ArrayList(s.length / 2)
for (i in 0..9) {
buf = (buf shl 2) + map[chars[i].code]
}
seen[buf] = true
for (i in 10 until chars.size) {
buf = (buf shl 2 and 0xFFFFF) + map[chars[i].code]
if (seen[buf]) {
if (!added[buf]) {
ans.add(String(chars, i - 9, 10))
added[buf] = true
}
} else {
seen[buf] = true
}
}
return ans
}
}